View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_50 (Length: 228)
Name: NF11475_low_50
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 175
Target Start/End: Complemental strand, 30685098 - 30684939
Alignment:
| Q |
16 |
cagaaatatcatcttcccttgccttcttagaagaagtctcttcactgcatttcgagtcattcaatacaaaaatgtgtcaaacatatataagtcggatccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30685098 |
cagaaatatcatcttcccttgccttcttagaagaagtctcttcactgcatttcgagtcattcaatacaaaaatgtgtcaaacatatataagtcggatccg |
30684999 |
T |
 |
| Q |
116 |
gatttgctaactttaaggcaggaaaatcacggtgactttgtgtctatttctcttatattg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30684998 |
gatttgctaactttaaggcaggaaaatcacggtgactttgtgtttatttctcttatattg |
30684939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 23 - 105
Target Start/End: Complemental strand, 28467811 - 28467729
Alignment:
| Q |
23 |
atcatcttcccttgccttcttagaagaagtctcttcactgcatttcgagtcattcaatacaaaaatgtgtcaaacatatataa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28467811 |
atcatcttcccttgccttcttagaagaagtctcttcactgcatttagagtcattcaatacaaaaatgtgtcgaacatatataa |
28467729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 28486299 - 28486212
Alignment:
| Q |
19 |
aaatatcatcttcccttgccttcttagaagaagtctcttcactgcatttcgagtcattcaataca-aaaatgtgtcaaacatatataa |
105 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
28486299 |
aaatatcatcttcccctgccttcttagaagaagtctcttcactgcatttagaatcattcaatacaaaaaatgtgtcaaacatatataa |
28486212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 168
Target Start/End: Complemental strand, 20135608 - 20135565
Alignment:
| Q |
125 |
actttaaggcaggaaaatcacggtgactttgtgtctatttctct |
168 |
Q |
| |
|
|||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
20135608 |
actttaaggcaggaaagttacggtgacttagtgtctatttctct |
20135565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University