View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_54 (Length: 219)
Name: NF11475_low_54
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 22 - 204
Target Start/End: Original strand, 1559932 - 1560114
Alignment:
| Q |
22 |
aaggtgggcatgatagtaatgccccatcgagtgaaaactcataccctatgggtgtccgaaattggatcctctcaatcgccatatgcggtatatattagtc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1559932 |
aaggtgggcatgatagtaatgccccatcgagtgaaaactcataccctataggtgtccgaaattggatcctctcaatcgccatatgcggtatatattagtc |
1560031 |
T |
 |
| Q |
122 |
tgtggacatgtgattggatgttattgggtaggatactacttctcactttgtggtaacaatgcgtagttaccaactctcctatg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1560032 |
tgtggacatgtgattggatgttattgggtaggatactacttctcactttgtggtaacaatgcgtagttaccaactctcctatg |
1560114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 22 - 200
Target Start/End: Original strand, 2089838 - 2090019
Alignment:
| Q |
22 |
aaggtgggcatgatagtaatgccccatcgagtgaaaactcataccctatgggtgtccgaaattggatcctctcaatcgccatatgcggtatatattagtc |
121 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2089838 |
aaggttggcatgatagtaacaccccatcgagtggaaactcataccctatgggtgtccgaaattggatcctctcaatcaccatatgcggtatatattagtg |
2089937 |
T |
 |
| Q |
122 |
tgtggacatgtgattggatgttattgggtaggatactacttctcactttgtggtaacaatgc---gtagttaccaactctcc |
200 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2089938 |
tgtgaacatgtgattggatatttttgggtaggatactacttctcactttgtggtaacaatgcttggtagttaccaactctcc |
2090019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University