View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11475_low_57 (Length: 217)
Name: NF11475_low_57
Description: NF11475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11475_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 36 - 205
Target Start/End: Original strand, 50510195 - 50510364
Alignment:
| Q |
36 |
cattccatacttgtgttgctgcattacatctgacaaacacatgtcaatcattctcgtaattagtttcacagcgaggatggcaattttagtattgtaattg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50510195 |
cattccatacttgtgttgctgcattacatctgagaaacacatgtcaatcattctcgtaattagtttcacagcgaggatggcaattttagtattgtaattg |
50510294 |
T |
 |
| Q |
136 |
ttaatttgttagtttatgttgaatgtggaagtcgaacctgaaaccaactttatcactctatttatttatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50510295 |
ttaatttgttagtttatgttgaatgtggaagtcgaacctgaaaccaactttatcactctatttatttatt |
50510364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University