View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11477_low_8 (Length: 297)
Name: NF11477_low_8
Description: NF11477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11477_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 7381458 - 7381681
Alignment:
| Q |
1 |
ttgaaaagttaagtgatgatgtggagtctcaaaagagaagcttagttggcaaacccaaaagccttattcatgttgggcaaaaaactctttcacctgttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7381458 |
ttgaaaagttaagtgatgatgtggagtctcaaaagagaaacttagttggcaaacccaaaagctttattcatgttgggcaaaaaactctttcatctgttga |
7381557 |
T |
 |
| Q |
101 |
catagaaaggtaggaagggttatgacaaattaagaaagtacgtggaaattatacttagggggtgcttgatattcaatttgtgattacttttatttttatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381558 |
catagaaaggtaggaagggttatgacaaattaagaaagtacgtggaaattatacttagggggtgcttgatattcaatttgtgattacttttatttttatg |
7381657 |
T |
 |
| Q |
201 |
aagttaatttgtgattacttattt |
224 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
7381658 |
aagataatttgtgattacttattt |
7381681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University