View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11478_high_7 (Length: 253)
Name: NF11478_high_7
Description: NF11478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11478_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 17470707 - 17470942
Alignment:
| Q |
18 |
aacatgtaagaaaatacctcggttttctaggtacaacaatttcatacgcaaatcatcacctgccttagcaagagaaagagatgcctccccatgcaaaggc |
117 |
Q |
| |
|
|||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17470707 |
aacatgtaggaaagtacctcggttttccaggtacaacaatttcatacgcaaatcatcccctgccttagcaagagaaagagatgcctccccatgtaaaggc |
17470806 |
T |
|
| Q |
118 |
tcccttatctcagcttgctctaatatctctatacataatcgatcattcgaagaaacctttgcttcctcagtagatttataataatccacagctttcgtac |
217 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| || |||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17470807 |
tcccttctctcagcttgctccaatatctctatgcacaatcgatcattcgaagaaacttttccttcctcagtagatttataataatccacagctttcgtac |
17470906 |
T |
|
| Q |
218 |
aacgctttgaaatctgaagagcttttctgccatcca |
253 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17470907 |
aacgttttgaaatctgaagagcttttctgccatcca |
17470942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University