View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11479_high_8 (Length: 249)
Name: NF11479_high_8
Description: NF11479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11479_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 234
Target Start/End: Original strand, 18191396 - 18191619
Alignment:
| Q |
11 |
gtgagatgaatagggaaactggaactactttgctgcagttcggaatgaaaagagaaatccaaagctagaagctactcatttggaaaaggccaaggagctt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18191396 |
gtgatatgaatagggaaactggaactacttcgctgcagttcggaatgaaaagagaaatccaaagctagaagctactcatttggaaaaggccaaggagctt |
18191495 |
T |
 |
| Q |
111 |
tatacaagagtaggttttctcatctttcttacttctatccgaataggagccacttttgcatgtttgtgattccttctaagcttttgatccctagacttat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18191496 |
tatacaagagtaggttttctcatctttcttacttctatccgaatgggagccacttttgcatgtttgtgattccttctaagcttttgatccctagacttat |
18191595 |
T |
 |
| Q |
211 |
ggttatgattgaagaaatttgatg |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18191596 |
ggttatgattgaagaaatttgatg |
18191619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University