View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11479_low_9 (Length: 285)
Name: NF11479_low_9
Description: NF11479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11479_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 266
Target Start/End: Complemental strand, 17591570 - 17591322
Alignment:
| Q |
18 |
gttctcatatcccctcgtaataggtgttgcgtgttttgctttcgacacaacgagaatgttagccatatgttttttctatatgctccttgagtttgaagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17591570 |
gttctcatatcccctcgtaataggtgttgcgtgttttgctttcgacacaacgagaatgttagccatatgttttttctatatgctccttgagtttgaagat |
17591471 |
T |
 |
| Q |
118 |
ttggaaaacggtttgcaatagtctggtgcttctggatgactaggaagtttgacgtggagacgtatcattgcgcgcattaaccttcgtcacgcttgcaact |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17591470 |
ttggaaaacggtttgcaatagtctggtgcttgtggatgactacgaagtttgacgtggagacgtatcattgcgcgcattaaccttcgtcacgcttgcaact |
17591371 |
T |
 |
| Q |
218 |
gttttaattctgcattgtccaaattattgcagctaacggataccgccct |
266 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
17591370 |
gttttaattctgcatcgtccaaattattgcagctatcggataccgccct |
17591322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University