View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_high_14 (Length: 237)
Name: NF1147_high_14
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_high_14 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 31 - 210
Target Start/End: Original strand, 7424659 - 7424839
Alignment:
| Q |
31 |
ccaactaaattggtagaggaagtgaaggtgctctcatggaggtggaaggtacatcggctgaaaacgcctacttgtatgttttatgaatggtgttgggatc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7424659 |
ccaactaaattggtagaggaagtgaaggtgctctcatggaggtggaaggtacatcggctgaaaacgcctacttttatgttttatgaatggtgttgggatc |
7424758 |
T |
|
| Q |
131 |
cgggagaatgcctcaggagaaagccggcctgaggggtttgaa-ggggagcaggttttggttgttagatatggtgtttggtt |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7424759 |
cgggagaatgcctcaagagaaagccggcctgaggggtttgaagggggagcaggttttggttgttagatatggtgtttggtt |
7424839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 213
Target Start/End: Original strand, 7424833 - 7424862
Alignment:
| Q |
184 |
tttggttgttagatatggtgtttggttata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7424833 |
tttggttgttagatatggtgtttggttata |
7424862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 135
Target Start/End: Complemental strand, 243264 - 243167
Alignment:
| Q |
38 |
aattggtagaggaagtgaaggtgctctcatggaggtggaaggtacatcggctgaaaacgcctacttgtatgttttatgaatggtgttgggatccggga |
135 |
Q |
| |
|
||||||||||||||||||| || ||||| |||| ||||| |||||||||||||||| || | |||||||| || ||||||| ||||||||||||| |
|
|
| T |
243264 |
aattggtagaggaagtgaacgttctctcttggacttggaatctacatcggctgaaaacatcttcatgtatgttctaagaatggttttgggatccggga |
243167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 213
Target Start/End: Original strand, 24356254 - 24356309
Alignment:
| Q |
157 |
gcctgaggggtttgaagggg-agcaggttttggttgttagatatggtgtttggttata |
213 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24356254 |
gcctaaggggtttgaagggggagcaggttttggttgtt--atatggtgtttggttata |
24356309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University