View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_low_25 (Length: 269)
Name: NF1147_low_25
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 141 - 242
Target Start/End: Complemental strand, 39519938 - 39519837
Alignment:
| Q |
141 |
gttggttgatgttttatgaaaatgtacatacatacagggaagaaggaggaggaagtgagttgaagccaatggatgctgagcaactgagagagcaaggtca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
39519938 |
gttggttgatgttttatgaaaatgtacatacatacagggaagaaggaggaggaagtgagttgaaggcaatggatgctgagcaactgagagaacaaggtca |
39519839 |
T |
 |
| Q |
241 |
ta |
242 |
Q |
| |
|
|| |
|
|
| T |
39519838 |
ta |
39519837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 141 - 242
Target Start/End: Complemental strand, 39532396 - 39532295
Alignment:
| Q |
141 |
gttggttgatgttttatgaaaatgtacatacatacagggaagaaggaggaggaagtgagttgaagccaatggatgctgagcaactgagagagcaaggtca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
39532396 |
gttggttgatgttttatgaaaatgtacatacatacagggaagaaggaggaggaagtgagttgaaggcaatggatgctgagcaactgagagaacaaggtca |
39532297 |
T |
 |
| Q |
241 |
ta |
242 |
Q |
| |
|
|| |
|
|
| T |
39532296 |
ta |
39532295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 66
Target Start/End: Complemental strand, 39520057 - 39520004
Alignment:
| Q |
13 |
aatatgtaagtcacggcacaattctatgaatctaactcgatcataacattaaac |
66 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39520057 |
aatatgtaagtcacgacacaattctatcaatctaactcgatcataacattaaac |
39520004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University