View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_low_26 (Length: 265)
Name: NF1147_low_26
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 221
Target Start/End: Original strand, 27481028 - 27481226
Alignment:
| Q |
23 |
accacagattgaattttttctatctatgatccatcattggatgatttactcaattatatcaatattaatttataaacctatctttttgcatgaatctgac |
122 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27481028 |
accagagattgaattttttctatctatgatccatcattggatgatttactcaattatatcaatattaatatataaacctatctttttgcatgaatctgac |
27481127 |
T |
|
| Q |
123 |
actttagaattcatgtttaaattcttatggtataattatatcaannnnnnnnnnnnnaaattcatggatcatagataacttaatgaatttacttgtaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27481128 |
actttagaattcatgtttaaattcttatggtataattatatcaattttttcatgtttaaattcatggatcatagataacttaatgaatttacttgtaac |
27481226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 23 - 81
Target Start/End: Original strand, 27489128 - 27489186
Alignment:
| Q |
23 |
accacagattgaattttttctatctatgatccatcattggatgatttactcaattatat |
81 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
27489128 |
accagagaatgaatattttctatctatgattcatccttggatgatttactcaattatat |
27489186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 27501997 - 27501961
Alignment:
| Q |
51 |
atccatcattggatgatttactcaattatatcaatat |
87 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27501997 |
atccatccttggatgatttactcaattatatcaatat |
27501961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University