View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_low_29 (Length: 264)
Name: NF1147_low_29
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 2101494 - 2101744
Alignment:
| Q |
11 |
cagagaggtgaatcgttcatcttcttcatttatgaatgattaggatctgtttggcaaaccgaaaatttggattatgtttcataagcttttaaaaaagttt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2101494 |
cagagaggtgaatcgttcatcttcttcatttatgaatgattaggatctgtttggcaaaccgcaaatttggattatgtttcataagcttttaaaaaagttt |
2101593 |
T |
|
| Q |
111 |
tgttttgtaattttcacgttttcatgagcttatagtttatatttaccggcttatatga-ttttttataacctttatcatttttcattctcaattttaacc |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2101594 |
tgttttgtaattttcacgttttcacgagcttatagtttatatttacaggcttatatgatttttttataacctttatcatttttcattctcaattttaacc |
2101693 |
T |
|
| Q |
210 |
ttgtagctttagttgaactaacttattagacactacacatgttaggtgtga |
260 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2101694 |
ttgtagctttagttgaactaatttattagacactacacatgttaggtgtga |
2101744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 40 - 166
Target Start/End: Complemental strand, 39185054 - 39184928
Alignment:
| Q |
40 |
ttatgaatgattaggatctgtttggcaaaccgaaaatttggattatgtttcataagcttttaaaaaagttttgttttgtaattttcacgttttcatgagc |
139 |
Q |
| |
|
|||| |||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
39185054 |
ttatcaatggttaggatctgtttggcaaaccgcaaatttggattatgttttataagcttttaaaagagttttgttttgtaattttcacgttttcaagagc |
39184955 |
T |
|
| Q |
140 |
ttatagtttatatttaccggcttatat |
166 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39184954 |
ttatagtttatatttaccggcttatat |
39184928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 226
Target Start/End: Complemental strand, 39184892 - 39184848
Alignment:
| Q |
182 |
ttatcatttttcattctcaattttaaccttgtagctttagttgaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39184892 |
ttatcatttttcattctcaattttaaccttgtagctttaattgaa |
39184848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University