View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_low_32 (Length: 251)
Name: NF1147_low_32
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 45682783 - 45683024
Alignment:
| Q |
1 |
cttggtcttgtaataatcccatcatgaatgaatctggggaagggttgcacccattatggatctatgttaggtttcctttacatctagaaaaagctaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682783 |
cttggtcttgtaataatcccatcatgaatgaatctggggaagggttgcacccattatggatctatgttaggtttcctttacatctagaaaaagctaattc |
45682882 |
T |
|
| Q |
101 |
cactactcaaacctttagatgaattaaatttgacttaagtttgaactcccagtattttgtatattttatataatatatcgtaataagttaaaccgaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45682883 |
cactactcaaacctttagatgaattaaatttgacttaagtttgaactcccagtattttgtatattttatataatatatcgtaataagttaaaccaaggaa |
45682982 |
T |
|
| Q |
201 |
tctgttccttttggatgaactgagaagcaattgtagtattat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45682983 |
tctgttccttttggatgaactgagaagcaattgtagtattat |
45683024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University