View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_low_34 (Length: 251)
Name: NF1147_low_34
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_low_34 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 27 - 251
Target Start/End: Complemental strand, 47365050 - 47364823
Alignment:
| Q |
27 |
aactcattgccaaaataaacacttagtcaaataaacattacacctaccttctcttgagtggaatgtgtgtc--gtgtaaagagcttctttaccatgctaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
47365050 |
aactcattgccaaaataaacacttagtcaaataaacattacacctaccttctcttgagtggaatgtatgtcccgtgtaaagagcttctttaccatgctaa |
47364951 |
T |
|
| Q |
125 |
accaacccatcttggccatttagaaatatcacacagactaacttcagtttctgttatctgaa-aattgctcgttggagtcttctctttttctgcatgaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364950 |
accaacccatcttggccatttagaaatatcacacagactaacttcagtttctgttatctgaagaattgctcgttggagtcttctctttttctgcatgaat |
47364851 |
T |
|
| Q |
224 |
tacaaatttacaaatatcttcatgtgaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47364850 |
tacaaatttacaaatatcttcatgtgaa |
47364823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University