View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1147_low_40 (Length: 214)
Name: NF1147_low_40
Description: NF1147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1147_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 5 - 106
Target Start/End: Complemental strand, 35710693 - 35710592
Alignment:
| Q |
5 |
gccttaccaaacattgacatatcatatcacatgcagttggtccaagttattcttttcgtttcatgtcaggttgtattgcataataccagctgctgatgat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35710693 |
gccttaccaaacattgacatatcatatcacatgcaattggtccaagttattcttttcgtttcatgtcaggttgtattgcataataccagctgctgatgat |
35710594 |
T |
|
| Q |
105 |
gt |
106 |
Q |
| |
|
|| |
|
|
| T |
35710593 |
gt |
35710592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University