View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11480_high_13 (Length: 396)
Name: NF11480_high_13
Description: NF11480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11480_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 118 - 266
Target Start/End: Original strand, 21254664 - 21254812
Alignment:
| Q |
118 |
attttccccaatttctaggatttccgtttctcctttcatcagagcaaattcatttcatttcggtttggattcccttcactccttgtttgttttcttgatt |
217 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |||||||||||| ||||||||||||||| ||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
21254664 |
atttttcccaatttctagggtttccgtttcgtctttcatcagagaaaattcatttcatttatgtttggattcctttcacttcttgtttgttttcttgatt |
21254763 |
T |
|
| Q |
218 |
ggaatcttcttcgttgtttaatttcaaggttccttcgatttcagaattc |
266 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
21254764 |
ggaatcttcttccttgttcaatttcaaggttccttcaatttcagaattc |
21254812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University