View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11480_low_20 (Length: 300)
Name: NF11480_low_20
Description: NF11480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11480_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 287
Target Start/End: Original strand, 47454844 - 47455119
Alignment:
| Q |
15 |
tcaataccattttaaagtttgtggttgcgtctaacacaatcctttaaaacagactcgtgtaggtgagacaaaccaatcacactttaaaccaacacataag |
114 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47454844 |
tcaataccattttaaaatttgtggttgtgtctaacacaatcctttaaaaccgactcgtgtaggtgagacaaaccaatcacactttaaaccaacacataac |
47454943 |
T |
 |
| Q |
115 |
agttaatctcattcatactcatttcccannnnnnnnnnnnnnnnn---acttaggattagatggttagaccaagagttgtcttttttatgatagttttag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47454944 |
agttaatctcattcatactcatttcccaattattattattattattatacttaggattagatggttagaccaagagttgtcttttttatgatagttttag |
47455043 |
T |
 |
| Q |
212 |
ttacaaatctgactttgaggtgtctagaataacggtatttttctacattatcgttcccataaaatttggctcccct |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47455044 |
ttacaaatctgactttgaggtgtctagaataacggtatttttctacattatcgttcccataaaatttggctcccct |
47455119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University