View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11480_low_22 (Length: 289)
Name: NF11480_low_22
Description: NF11480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11480_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 20 - 279
Target Start/End: Original strand, 42183965 - 42184224
Alignment:
| Q |
20 |
cccttcatccttatctccaatcttcccttgctttgcataatagcagctttgagggttcaaataagcaaccaaggtgagtttatatctgtcttttgctata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42183965 |
cccttcatccttatctccaatcttccctttctttgcataatagcagctttgagggttcaaataagcaaccaaggtgagtttatatctgtattttgctata |
42184064 |
T |
 |
| Q |
120 |
tctgtttagaatcacatgttttgattcatatcatatgagtttcatgaaatcaggttgccaatgtgattttgttgaaggcttaagcttcaaagtatagctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42184065 |
tctgtttagaatcacatgttttgattcatatcatatgagtttcatgaaatcaggttgccaatgtgattttgttgaaggcttaagcttctaagtatagctt |
42184164 |
T |
 |
| Q |
220 |
ttgctaaaatctgtggttcttctaaatttatcatgaatccaaacatgtactatgcctatg |
279 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184165 |
ttgctaaaatctgtgattcttctaaatttatcatgaatccaaacatgtactatgcctatg |
42184224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University