View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11480_low_32 (Length: 220)
Name: NF11480_low_32
Description: NF11480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11480_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 27 - 204
Target Start/End: Original strand, 3042670 - 3042848
Alignment:
| Q |
27 |
tcaaaaaacagtgtgtttctaaacataaaattaaaaaacactaacatataattttattggatgcatgtcgtgcaataacatggttatcacttagggtcag |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3042670 |
tcaaaaaacagtgtgtttctaaacataaaattaaaaaatactaacatataattttatcagatgcatgtcgtgcaataacatgggtatcacttagggtcag |
3042769 |
T |
|
| Q |
127 |
agttc-aacattaatttattacattgttagtatttaactccttctgttaagctcaatcaaattagtgcaacaacttttt |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
3042770 |
agttcgaacattaatttattacattgttagaatctaactccttcggttagactcgatcaaattagtgcaacaacttttt |
3042848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University