View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11480_low_33 (Length: 219)
Name: NF11480_low_33
Description: NF11480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11480_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35815910 - 35815702
Alignment:
| Q |
1 |
ttcttatgatcaactttcacagacttatacaaaagatcaggtgtaggaacaataggcaaagttggaaagaatttagctaaaaaagttaaaatctgaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35815910 |
ttcttatgatcaactttcacagacttatacaaaagatcaggtgtaggaacaataggcaaagttggaaagaatttagctaaaaaagttaaaatctgaggaa |
35815811 |
T |
 |
| Q |
101 |
ttggccatttgggtctaaccttatcagagattttacacatgggtgctaccaaaatagcaccttgaaacccttttggatcagcaaaatgaatcaaaagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35815810 |
ttggccatttgggtctaaccttatcagagattttacacatgggtgctaccaaaatagcaccttgaaacccttttggatcagcaaaatgaatcaaaagact |
35815711 |
T |
 |
| Q |
201 |
aatagcacc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
35815710 |
aatagcacc |
35815702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University