View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11481_high_14 (Length: 300)
Name: NF11481_high_14
Description: NF11481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11481_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 161 - 266
Target Start/End: Original strand, 23575935 - 23576040
Alignment:
| Q |
161 |
taccaatttacaccctttcacccatcatgttttcaggaattaaaaatattggacaagttttctgacaaatttaaccataccggaaatcccatagaatact |
260 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23575935 |
taccaatttacaccctttcacctatcatgttttcaggaattaaaaatagtggacaagttttctgacaaatttaaccatacgggaaatcccatagaatact |
23576034 |
T |
|
| Q |
261 |
ttgggg |
266 |
Q |
| |
|
|||||| |
|
|
| T |
23576035 |
ttgggg |
23576040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University