View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11481_high_14 (Length: 300)

Name: NF11481_high_14
Description: NF11481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11481_high_14
NF11481_high_14
[»] chr4 (1 HSPs)
chr4 (161-266)||(23575935-23576040)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 161 - 266
Target Start/End: Original strand, 23575935 - 23576040
Alignment:
161 taccaatttacaccctttcacccatcatgttttcaggaattaaaaatattggacaagttttctgacaaatttaaccataccggaaatcccatagaatact 260  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||    
23575935 taccaatttacaccctttcacctatcatgttttcaggaattaaaaatagtggacaagttttctgacaaatttaaccatacgggaaatcccatagaatact 23576034  T
261 ttgggg 266  Q
    ||||||    
23576035 ttgggg 23576040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University