View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11481_high_8 (Length: 420)
Name: NF11481_high_8
Description: NF11481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11481_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 16 - 412
Target Start/End: Original strand, 297978 - 298365
Alignment:
| Q |
16 |
actaataataagtaaaaatcaattcattgtttcattcattatggtggtgggtgactatcatatttaactgtatattctatatgtataattcnnnnnnnct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
297978 |
actaataataagtaaaaatcaattcattgtttcattcattatggtggtgggtgactatcatatttaactgtatattctatatgtataattctttttttct |
298077 |
T |
 |
| Q |
116 |
tgccaagttgcttgaggatcatttaatcaatacaagtcttttaagggatttgaatagaaaaaatatttttagtgataacaaaacttttctcaaaatattt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298078 |
tgcccagttgcttgaggatcatttaatcaata----tc-tttaagggatttgaatagaaaaaatatttttagtgataacaaaacttttctcaaaatattt |
298172 |
T |
 |
| Q |
216 |
gattttgatttcttggttccagaagttctccatggtgattgcaactctatagtgattcctttatttatttannnnnnncaatctgatttacttctagtac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| | ||||||||||| |
|
|
| T |
298173 |
gattttgatttcttggttccagaagttctccatggtgattgcaactctatagtgattcctttttttatttatttttttcaatc----tcacttctagtac |
298268 |
T |
 |
| Q |
316 |
cggtattattgtacactctgttattgatggttagtgaagatgatattgatgagattgtgttcagaaacatgtcattatgactacttatgttcatctc |
412 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
298269 |
cggtcttattgtacactctgttattgatagttagtgaagatgatattgatgagattgtgttcagaaacatgtcattatgactacttatgttcttctc |
298365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University