View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11481_low_10 (Length: 403)
Name: NF11481_low_10
Description: NF11481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11481_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 156 - 386
Target Start/End: Original strand, 10233312 - 10233542
Alignment:
| Q |
156 |
ctctgagacatagtctggtcatctttaggcaaactattgaaaataggtatataaccatatgctagtcagttacgacaacgattatagacagaatacaaaa |
255 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10233312 |
ctctaagacatagtctggtcatctttaggcaaactattgaaaataggtatataaccatatgctagtcagttacgacaacgattatagacagaatacaaaa |
10233411 |
T |
 |
| Q |
256 |
gaaaaacacatgattgattaagggtaactaaccttttcctgaacatgttgatctcaggcatgtcatcattgataaacaatttagtgaaggagtaagtgtt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10233412 |
gaaaaacacatgattgattaagggtaaccaacctttccctgaacatgttgatctcaggcatgtcatcattgataaacaatttagtgaaggagtaagtgtt |
10233511 |
T |
 |
| Q |
356 |
cgaaacactcagtgggtagcgtcctgagttt |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10233512 |
cgaaacactcagtgggtagcgtcctgagttt |
10233542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 303 - 355
Target Start/End: Complemental strand, 20994773 - 20994721
Alignment:
| Q |
303 |
ttgatctcaggcatgtcatcattgataaacaatttagtgaaggagtaagtgtt |
355 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| || ||||||||||| ||||| |
|
|
| T |
20994773 |
ttgatctcaggaatgtcttcattaataaacaacttggtgaaggagtatgtgtt |
20994721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University