View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11481_low_17 (Length: 272)
Name: NF11481_low_17
Description: NF11481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11481_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 23 - 262
Target Start/End: Complemental strand, 36117446 - 36117207
Alignment:
| Q |
23 |
ccgaatcagattccggatagtaacgtgacaaggaaggatagttcgaattacccatgttccagttttcttctttttcatttgaatcatccaatttttcttc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36117446 |
ccgaatcagattccggatagtaacgtgacaacgaaggatagttcgaattacccatgttccagttttcttctttttcatttggatcatccaatttttcttc |
36117347 |
T |
|
| Q |
123 |
atcttcatatccttcgtatattatctccaatggtgctctcacgttccattccacaaaacttgaacttgattccaaacttttttgggaatccacctctttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36117346 |
atcttcatatccttcgtatattatctccaatggtgctctcacgttccattccataaaacttgaacttgattccaaacttttttgggaatccacctctctt |
36117247 |
T |
|
| Q |
223 |
tctgaatggtgcacttgctccagagactcaatttcctttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36117246 |
tctgaatggtgcacttgctccagagactcaatttcctttg |
36117207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University