View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11481_low_21 (Length: 238)
Name: NF11481_low_21
Description: NF11481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11481_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 48653828 - 48653606
Alignment:
| Q |
1 |
ctcatgatgctaattatgttgggtctgattatggtctattctactctgacctagacaagatgatgcattcgggtgagttaatgtattccattccatcacc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48653828 |
ctcatgatgctaattttgttgggtctgattatggtctattgtactctgacctagacaagatgatgcattcgggtgagttaatgtattccattccaccacc |
48653729 |
T |
|
| Q |
101 |
accactttttgaggattatcagaacttatcatccgttgaagaatatgatgatgataatgacgatcctttttctcatcaatcattcctttggaactggaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48653728 |
accactttttgaggattatcagaacttatcatcagttgaagaatatgatgatgataatggcgatcctttttctcatcaatcattcctttggaactggaat |
48653629 |
T |
|
| Q |
201 |
ttctgattcttgatcatatatat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48653628 |
ttctgattcttgatcatatatat |
48653606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 199
Target Start/End: Complemental strand, 48645292 - 48645241
Alignment:
| Q |
145 |
atgatgatgataatgacgatcctttttctcatcaatcattcctttggaactggaa |
199 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
48645292 |
atgatgatgataatgac---ccattttcccatcaatcattcctttggaactggaa |
48645241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University