View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_high_25 (Length: 374)
Name: NF11482_high_25
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 32679392 - 32679581
Alignment:
| Q |
1 |
ggaaaaactgcaaaaattgaatccttggtaaaaatatttcagatttaggaatgattaactgcgtcaacaagtggtttactagttaagcacgtgcaaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32679392 |
ggaaaaactgcaaaaattgaatccttggtaaaaatatttcagatttaggaatgattaactgcgtcaacaagtggtttaccagttaagcacgtgcaaaata |
32679491 |
T |
 |
| Q |
101 |
attagagttcacacttatattctcaaaaatttaatcattgacaactgaaaatagataaattctccaaacactgcattccaagtttgcaac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32679492 |
attagagttcacacttatattctcaaaaatttaatcattgacaactgaaaatagataaattctccaaagactgcattccaagtttgcaac |
32679581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 241 - 355
Target Start/End: Complemental strand, 54225004 - 54224890
Alignment:
| Q |
241 |
tgatctcactcctcttcacaacaagagtgtcaataatcaactcattgatgggggaaccaaaagagatattaaggaagcgctttccatcgactccaaacaa |
340 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54225004 |
tgatctcattcaccttcacaacaagagtgtcaatcaccaactcattaatgggggaaccaaaagagatattaaggaagcgctttccatcgactccaaacaa |
54224905 |
T |
 |
| Q |
341 |
gaagtcctgaagtgg |
355 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
54224904 |
gaagtcctgaagtgg |
54224890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 153 - 190
Target Start/End: Complemental strand, 54225093 - 54225056
Alignment:
| Q |
153 |
agataaattctccaaacactgcattccaagtttgcaac |
190 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
54225093 |
agataaattctccaaagattgcattccaagtttgcaac |
54225056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University