View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_high_36 (Length: 323)
Name: NF11482_high_36
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 68 - 306
Target Start/End: Complemental strand, 373642 - 373396
Alignment:
| Q |
68 |
taattcaaaattaattaatgtcaaaaaagaatcaaacata--------aactcaataattttgtcgtaaataaacagagtctcgctctgaaaaaccctaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373642 |
taattcaaaattaattaatgtcaaaaaagaatcaaacatataattataaactcaataattttgtcgtaaataaacagagtctcgctctgaaaaaccctaa |
373543 |
T |
|
| Q |
160 |
acccttgtaagcaaaaatctgaacgaagaagaaagcagtatgggaaaaattcctccttcatttcgatctgcactctcaaaccctaatttgattcaccgtt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373542 |
acccttgtaagcaaaaatctgaacgaagaagaaagcagtatgggaaaaattcctccttcatttcgatctgcactctcaaaccctaatttgattcaccgtt |
373443 |
T |
|
| Q |
260 |
catcttcattgattccttcttctcccaaaccccatcattttcctaac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373442 |
catcttcattgattccttcttctcccaaaccccatcattttcctaac |
373396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 40
Target Start/End: Complemental strand, 373672 - 373644
Alignment:
| Q |
12 |
agagagtgaagtgcttttgcaataatgaa |
40 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
373672 |
agagagtgaagtgcttttgcaataatgaa |
373644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University