View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_high_47 (Length: 267)
Name: NF11482_high_47
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 9 - 248
Target Start/End: Original strand, 54699224 - 54699454
Alignment:
| Q |
9 |
tagagagttttccaccgtctctataagcattaagcaacgataattgcgacagtgtgcctatttaacttgtattgtgatgattctctaatggaagggccac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54699224 |
tagagagttttccaccgtctctataagcattaagcaacgataattgcgacagtgtgcctatttaacttgtattgtgatgattctctaatggaagggc--- |
54699320 |
T |
 |
| Q |
109 |
ctgggccaccttgtttcaatttcatggtagccatccactggcaccgccgcagctcgttggtccgtcgcatgccaccaccaactcaacattccttgctgcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54699321 |
------caccttgtttcaatttcatggtagccatccactggcaccaccgcagctcgttggtccgtcgcacgccaccaccaactcaacattccttgctgcc |
54699414 |
T |
 |
| Q |
209 |
gcatttgtctggtaagcattggccttcaaggttggcttaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54699415 |
gcatttgtctggtaagcattggccttcaaggttggcttaa |
54699454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University