View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_27 (Length: 384)
Name: NF11482_low_27
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 18 - 367
Target Start/End: Original strand, 8068019 - 8068368
Alignment:
| Q |
18 |
cacagatgttggttccggtgaagttgacttgaatttctccgatgagtgggaatcaccaaacgctgaaaccgttgagatcaccggcggtggttctggctca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
8068019 |
cacagatgttggttccggtgaagttgacttgaatttctccgatgagtgggaatcaccaaacgctgaaaccgttgagataatcggcggtggttctggctca |
8068118 |
T |
 |
| Q |
118 |
tcgtatcggaaccggcatcggattactcaaaatagcgatgaacaccgtcaattaggtggtttatcacttgcgtttgaagatccagtgaattcctccacgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8068119 |
tcgtatcggaaccggcatcggattactcaaaacagcgatgaacaccgtcaattaggtggtttatcacttgcgttcgaagatccagtgaattcctccacgg |
8068218 |
T |
 |
| Q |
218 |
tggcgacggcgaggattgtgcatcagtttcgtgcacacgacggcgttgcgtcttcgccttcggcacgtggacggcacatggcgacatcgttgccggtgaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8068219 |
tggcgacggcgaggattgtgcatcagtttcgtgcacacgacggcgttgcgtcttcgccttcggcacgtggacggcacatggcgacatcgttgccggtgaa |
8068318 |
T |
 |
| Q |
318 |
cgtgccggattggagtaagatactccgagttgactcggttgagtcgttac |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8068319 |
cgtgccggattggagtaagatactccgagttgactcggttgagtcgttac |
8068368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 309 - 350
Target Start/End: Original strand, 55142722 - 55142763
Alignment:
| Q |
309 |
gccggtgaacgtgccggattggagtaagatactccgagttga |
350 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55142722 |
gccggtaaacgtgccggattggagtaagatactccgagttga |
55142763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University