View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_38 (Length: 323)
Name: NF11482_low_38
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 40183157 - 40183017
Alignment:
| Q |
17 |
caatttgtagttggaactgtttgccaccaatgctaaggtgcataatggctgccaacactttccattttgtaacaagaaaaagttaaaaagatataaaaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40183157 |
caatttgtagttggaactgtttgccaccaatgctaaggtgcataatggctgccaacactttccattttgtaacaaaaaaaagttaaaaagatataaaaat |
40183058 |
T |
|
| Q |
117 |
acaagttcattacaagagcatgcaatgtactgatgtacaaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183057 |
acaagttcattacaagagcatgcaatgtactgatgtacaaa |
40183017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 184 - 315
Target Start/End: Complemental strand, 40182966 - 40182835
Alignment:
| Q |
184 |
cacctctcactgtttctgttatgccatatttaatatttgccatgaaattatatcataatatatcatgaatgtcaaccnnnnnnncaatggaataataaca |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40182966 |
cacctctcactgtttctgttatgccatatttaatatttgccatgaaattatatcataatatatcatgaatgtctacctttttttcaatggaataataaca |
40182867 |
T |
|
| Q |
284 |
caatataaattatcatcatcataattcttctc |
315 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
40182866 |
caacataaattatcatcatcataattcttctc |
40182835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University