View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_45 (Length: 297)
Name: NF11482_low_45
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 273
Target Start/End: Complemental strand, 45440221 - 45439963
Alignment:
| Q |
15 |
atgaatgtataaatcgctgtgttcagatgatcacttcgttactttccgactttgtaatcttcactattattttactaaagattgtatccattgaatcaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440221 |
atgaatgtataaatcgctgtgttcagatgatcactttgttactttccgactttgtaatcttcactattattttactaaagattgtatccattgaatcaaa |
45440122 |
T |
 |
| Q |
115 |
gaaagtaaatgagctggtatgatttagttcagtaacagataaaatgaaatcgtgttgcaccagtagtttagataaaatgaattagttggaagtagatgat |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440121 |
gaaagtaagtgagctggtatgatttagttcagtaacagataaaatgaaatcgtgttgcaccagtagtttagataaaatgaattagttggaagtagatgat |
45440022 |
T |
 |
| Q |
215 |
tgattgtttgatgtcataccatttacacattacaaagacttaacaatttatttggtcac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440021 |
tgattgtttgatgtcataccatttacacattacaaagacttaacaatttatttggtcac |
45439963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University