View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_55 (Length: 255)
Name: NF11482_low_55
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 40942203 - 40942443
Alignment:
| Q |
1 |
cattatgtttcactaagtagtctgattatgatgaagaaacgcatctattttttaagtttgctgattcagtatgacattgttatgttgttgaaatgactgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40942203 |
cattatgtttcactaagtagtctgattatgatgaagaaaggcatctattttttaagtttgctgattcagtatgacattgttatgttgttgagatgactgt |
40942302 |
T |
 |
| Q |
101 |
actttttatggtaaaactctgacggtatgcgtatgcatatgcttgcaggcatggccgttaatcagagaccggcgattctcggagttggtggatccattgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942303 |
actttttatggtaaaactctgacggtatgcgtatgcatatgcttgcaggcatggccgttaatcagagaccggcgattctcggagttggtggatccattgc |
40942402 |
T |
 |
| Q |
201 |
ttgaaggtcgatatccagtgtggggtttgtaccgggctctc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942403 |
ttgaaggtcgatatccagtgtggggtttgtaccgggctctc |
40942443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 233
Target Start/End: Original strand, 40924364 - 40924411
Alignment:
| Q |
186 |
tggtggatccattgcttgaaggtcgatatccagtgtggggtttgtacc |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
40924364 |
tggtggatccattgcttgaaggtcaatatccagcgaggggtttgtacc |
40924411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 191 - 233
Target Start/End: Original strand, 40908102 - 40908144
Alignment:
| Q |
191 |
gatccattgcttgaaggtcgatatccagtgtggggtttgtacc |
233 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
40908102 |
gatccattgcttgaaggtcaatatccagtgaggggtttgtacc |
40908144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 218
Target Start/End: Original strand, 55064217 - 55064249
Alignment:
| Q |
186 |
tggtggatccattgcttgaaggtcgatatccag |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
55064217 |
tggtggatccattgcttgaaggtcaatatccag |
55064249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University