View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_57 (Length: 254)
Name: NF11482_low_57
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 86 - 227
Target Start/End: Original strand, 46429219 - 46429360
Alignment:
| Q |
86 |
tctattttcatgatcatcagttaaagaattattcattggaccatatttacataatcacaagaatgatatcgaatctttcaagtagaacaatgtaagttga |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46429219 |
tctattttcatgatcatcagttaaagaattattcattggaccatatttacataatcacaagaatgatatcgaatctttcaagtagaacaatgtaagttga |
46429318 |
T |
|
| Q |
186 |
tggaaaagaaaactacttactgtgagctaggcaattttaatg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46429319 |
tggaaaagaaaactacttactgtgagctaggcaattttaatg |
46429360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 46425927 - 46425971
Alignment:
| Q |
165 |
aagtagaacaatgtaagttgatggaaaagaaaactacttactgtg |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
46425927 |
aagtagaacaatgaaagttgatggaaaagaagactactcactgtg |
46425971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 52 - 82
Target Start/End: Original strand, 46429166 - 46429196
Alignment:
| Q |
52 |
ttcaactgtcatacatggtagtttttgctaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46429166 |
ttcaactgtcatacatggtagtttttgctaa |
46429196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University