View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_58 (Length: 250)
Name: NF11482_low_58
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 40579593 - 40579355
Alignment:
| Q |
1 |
ttttaactcacgttcacttgcttctaaatttctcaatatcttatctatccagaataattcaatattgtaagaataattttaattcctatccttcaatatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40579593 |
ttttaactcacgttcacttgcttctaaatttctcaatattgtatctatccagaataattcaatattgtaagaagaattttaattcctatccttcaatatt |
40579494 |
T |
 |
| Q |
101 |
gtaagattttgttctgagagagcaacgtgattttcaataactgaagaagttcacatagtttctttctagcaactttcattttgtaaggattactagtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40579493 |
gtaagattttgttctgagagagcaacgtgattttcaataattgaagaagttcacatagtttctttctagcaactttcattttgtaaggattactagtata |
40579394 |
T |
 |
| Q |
201 |
gtattgagaacaactgacacactaaattatactcttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40579393 |
gtattgagaacaactgacacactaaattatactcttcat |
40579355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University