View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_66 (Length: 242)
Name: NF11482_low_66
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 46428972 - 46428749
Alignment:
| Q |
1 |
tctttcatgaaatacaa-atgtgggacttctaaaagttaactaaaacnnnnnnnnctctttcagcatgctcatatctcattacctagttagcttttgaat |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46428972 |
tctttcatgaaatacacgatgtgggacttctaaaagttaactaaaacttttttttctctttcagcatgctcatatctcattgcctagttagcttttgaat |
46428873 |
T |
 |
| Q |
100 |
taatatatgctatactaactttattgctgtgcctgttactgtgggtatcaagagtgcagaacagactccattttaattgcattcctttccatttcacaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46428872 |
taatatatgctatactaactttattgctgtgcctgttactgtgggtatcaagagtgtagaacagactccattttaattgcattcctttcca-ttcacaat |
46428774 |
T |
 |
| Q |
200 |
ttgcatgtgatgtgagggaagccac |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46428773 |
ttgcatgtgatgtgagggaagccac |
46428749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University