View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_69 (Length: 238)
Name: NF11482_low_69
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_69 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 30206963 - 30207187
Alignment:
| Q |
14 |
cacatgaatcacatgctactttccatatccacaacccaataatttcaccacctacacttccctttcaattccttcaaccatggtttccctttcaattcct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30206963 |
cacatgaatcacatgctactttccatatccacaacccaataatttcaccacctacacttccctttcaattccttcaaccatggtttccctttcaattcct |
30207062 |
T |
 |
| Q |
114 |
ttcttccccctcactccacaaaaaacaacttccccttctactaaattccaacccaaaaacaactacttaaatccattccatcacaataaacatcacagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30207063 |
ttcttccccctcactccacaaaaaacaacttccccttctactaaattccaacccaaaaacaactacttaaatccattccatcacaataaacatcacagaa |
30207162 |
T |
 |
| Q |
214 |
aagttatatgtgcttgcatcgctcc |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30207163 |
aagttatatgtgcttgcatcgctcc |
30207187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University