View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_70 (Length: 237)
Name: NF11482_low_70
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_70 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 3524618 - 3524396
Alignment:
| Q |
17 |
tgataaagggtgaaatcaagaagtggaactgaaaagtgtatggggatttggaggagaaaatcaatgggcttgacgtatatagcaactctagacttcaa-- |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524618 |
tgataaagggtgaaatcaagaagtggaactgaaaagtgtatggggatttggaggagaaaatcaatgggcttgacgtatatagcaactctagacttcaaat |
3524519 |
T |
 |
| Q |
115 |
atatgaataagagggtcttactaaagaggaggtcttaggtttgnnnnnnnntcggatctttggttgcttttgaagagtaaacatagtattatgtaccaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524518 |
atatgaataagagggtcttactaaagaggaggtcttaggtttgaaaaaaaatcggatctttggttgcttttgaagagtaaacatagtattatgtaccaaa |
3524419 |
T |
 |
| Q |
215 |
gagggagggtgaagtggttcaac |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3524418 |
gagggagggtgaagtggttcaac |
3524396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University