View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11482_low_71 (Length: 237)
Name: NF11482_low_71
Description: NF11482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11482_low_71 |
 |  |
|
| [»] scaffold0187 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 42185913 - 42185707
Alignment:
| Q |
18 |
ttggatgtctgttactgttagaatagcaattccggttcagaagaataaagatatgaaaaactcaatcaatttgattgtagttcctctcagttatttcaaa |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42185913 |
ttggatatctgttactgttagaatagcaattccggttcagaagaataaagatatgaaaaactcgatcaatttgattgtagttcctctcagttatttcaaa |
42185814 |
T |
 |
| Q |
118 |
tttaggatttacaacatccaacatgtatttacatactacggttcagattacaacgttacccttaatcagtaactatgcgctgtactcaacggtagctata |
217 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42185813 |
tttaggatttacaacatacaatatgtatttacatactaaggttcagattacaacgttacccttaatcagtaactatgcgctgtactcaacggtagctata |
42185714 |
T |
 |
| Q |
218 |
gtttgtg |
224 |
Q |
| |
|
||||||| |
|
|
| T |
42185713 |
gtttgtg |
42185707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 86
Target Start/End: Complemental strand, 42195591 - 42195549
Alignment:
| Q |
44 |
caattccggttcagaagaataaagatatgaaaaactcaatcaa |
86 |
Q |
| |
|
||||| ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
42195591 |
caatttcggttcaaaagaataaagatacgaaaaactcaatcaa |
42195549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 1808 - 1849
Alignment:
| Q |
141 |
tgtatttacatactacggttcagattacaacgttacccttaa |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
1808 |
tgtatttaaatactacggttcagattacaaaattacccttaa |
1849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 35052267 - 35052212
Alignment:
| Q |
31 |
actgttagaatagcaattccggttcagaagaataaagatatgaaaaactcaatcaat |
87 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||||| ||||||| ||| |||| |
|
|
| T |
35052267 |
actgttagaacagcaat-ccggttcaaaagaataaagatacgaaaaacgcaaacaat |
35052212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University