View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11483_high_6 (Length: 238)
Name: NF11483_high_6
Description: NF11483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11483_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 35703525 - 35703749
Alignment:
| Q |
1 |
cccgtattatttgtctgtgtattaatcttttatgtgacaccagtcctgcttgagaattgcaaccaggttcacaaccctatcatgattgctattgtctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35703525 |
cccgtattatttgtctgtgtattaatcttttatgtgacaccagtcctgcttgagaattgcaaccaggttcacaaccctatcatgattgctattgtctttg |
35703624 |
T |
 |
| Q |
101 |
--atagattatttgaagctgattgtcattggtgttcttaactggatcatttttcttttggttatggatatagtaggatagtagcttctgtaatgaaaatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35703625 |
tgatagattatttgaagctgattgtcattggtgttcttaactggatcatttttcttttggttatggatatagtaggatagtagcttctgtaatgaaaatt |
35703724 |
T |
 |
| Q |
199 |
acaaattttgttgcacggttaaact |
223 |
Q |
| |
|
||||||||||||||| || |||||| |
|
|
| T |
35703725 |
acaaattttgttgcatgggtaaact |
35703749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 10 - 155
Target Start/End: Original strand, 35708488 - 35708632
Alignment:
| Q |
10 |
tttgtctgtgtattaatcttttatgtgacac---cagtcctgcttgagaattgcaaccaggttcacaaccctatcatgattgctattgtcttt--gatag |
104 |
Q |
| |
|
||||||| ||||||| |||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| | |
|
|
| T |
35708488 |
tttgtctatgtattacacttttaagtgacactaccaatcctgcttgagaattgcaaccaggttcacaaccctatcatgattgctattgtctctgagatcg |
35708587 |
T |
 |
| Q |
105 |
attatttgaagctgattgtcattggtgttcttaactggatcatttttcttt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
35708588 |
attatttgaagc------tcattggtgttcttaactggataatttttcttt |
35708632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 95
Target Start/End: Complemental strand, 41107962 - 41107922
Alignment:
| Q |
55 |
aattgcaaccaggttcacaaccctatcatgattgctattgt |
95 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
41107962 |
aattgcaaacaggttcactaccctatcacgattgctattgt |
41107922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University