View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11484_high_18 (Length: 225)
Name: NF11484_high_18
Description: NF11484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11484_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 50567436 - 50567536
Alignment:
| Q |
16 |
agggtgtggcagattgacggcggcggcggccgatggtgggtgggttttggtttgaaggggatcaaggaagaagaagaaaaag---gcgtgaagcttctga |
112 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
50567436 |
agggtgtggcagatcgacggcggtagcggccggcggtgggtgggttttggtttgaaggggatcaaggaagaagaagaagaagaaagtgtgaagcttctga |
50567535 |
T |
 |
| Q |
113 |
g |
113 |
Q |
| |
|
| |
|
|
| T |
50567536 |
g |
50567536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 50 - 87
Target Start/End: Complemental strand, 50567080 - 50567043
Alignment:
| Q |
50 |
ggtgggtgggttttggtttgaaggggatcaaggaagaa |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50567080 |
ggtgggtgggttttggtttgaaggggatcaaggaagaa |
50567043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 50566968 - 50566930
Alignment:
| Q |
172 |
aaaaggtgtgccacatggcacacccttattggttgatgt |
210 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
50566968 |
aaaaggtgtgccgcatgacacacccttattggttgatgt |
50566930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 200
Target Start/End: Original strand, 50567593 - 50567622
Alignment:
| Q |
171 |
aaaaaggtgtgccacatggcacacccttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50567593 |
aaaaaggtgtgccacatggcacacccttat |
50567622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 170 - 203
Target Start/End: Original strand, 17431702 - 17431735
Alignment:
| Q |
170 |
aaaaaaggtgtgccacatggcacacccttattgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
17431702 |
aaaaaaggtgtgccacatggcacaccctgattgg |
17431735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University