View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11484_high_19 (Length: 217)
Name: NF11484_high_19
Description: NF11484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11484_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 34868719 - 34868534
Alignment:
| Q |
19 |
tatccattctcttataccatgatatgattgttttatttgttttagaagttgcttcaaattttaaactgatatgtcatcaatgttttgctttatgatgcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34868719 |
tatccattctcttataccatgatatgattgttttatttgttttagaagttgcttcaaattttaaactgatatgtcatcaatgttttgctttatgatgcaa |
34868620 |
T |
 |
| Q |
119 |
gtatattttattaatcacggatattgattaaaattttaaactaatatgttcatcaattaacttgtgtggctttctaacttcatctc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34868619 |
gtatattttattaatcacggatattgattaaaattttaaactaatatgttcatcaattaacttgtgtggctttctaacttcatctc |
34868534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 142
Target Start/End: Complemental strand, 34875933 - 34875851
Alignment:
| Q |
63 |
gaagttgcttcaaattttaaactgatatgt---catcaatgttttgctttatgatgcaagtatattttattaatcacggatat |
142 |
Q |
| |
|
||||||| ||||||||||||| | |||| | |||| |||||| | ||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
34875933 |
gaagttgattcaaattttaaaataatattttctcatccatgtttcggtttatgatgcaggtgtattttattaatcacagatat |
34875851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University