View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11484_low_17 (Length: 238)
Name: NF11484_low_17
Description: NF11484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11484_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 37645410 - 37645284
Alignment:
| Q |
7 |
gagcaatgtttcatagacacacttttacccacaccccattatacactcccatgtggcagcttatgtagcatttcaatttnnnnnnnttctaaccaaacca |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37645410 |
gagcaatgtttcgaagacacacttttacccacaccttattatacacccccatgtggcagcttatgtagcatttcaatttaaaaaatttctaaccaaacca |
37645311 |
T |
 |
| Q |
107 |
t--tctctctcaagtcaaaccgcgcac |
131 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
37645310 |
ttctctctctcaagtcaaaccgcgcac |
37645284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 224
Target Start/End: Complemental strand, 37645230 - 37645191
Alignment:
| Q |
185 |
atcatcaaccggttctttcttcatttcactccatgcattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37645230 |
atcatcaaccggttctttcttcatttcacttcatgcattt |
37645191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University