View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11484_low_9 (Length: 292)
Name: NF11484_low_9
Description: NF11484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11484_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 62 - 277
Target Start/End: Complemental strand, 5860315 - 5860100
Alignment:
| Q |
62 |
atcttgaattaatatagtacttaccaagagtgcctttttgtattgtgtaccaggaatttgagttggaaaagaattgtaaccattgtcaacaatccaataa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5860315 |
atcttgaattaatatagtacttaccaagagtgcctttttgtattgtgtaccaggaatttgagttggaaaagaattgtaaccattgtcaacaatccaataa |
5860216 |
T |
|
| Q |
162 |
ttcttctttagctcttccctcaaccttggctctagatttccaaaaactttgagaataccaacttcaaaagaaaactgcaaaaaatatggaccacctgatt |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5860215 |
ttcttctttagctcttccctcaacctcggctctagatttccaaaaactttgagaataccaacttcaaaagaaaactgcaaaaaatatggaccacctgatt |
5860116 |
T |
|
| Q |
262 |
aataattgaccctttg |
277 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5860115 |
aataattgaccctttg |
5860100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University