View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11485_high_14 (Length: 322)
Name: NF11485_high_14
Description: NF11485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11485_high_14 |
 |  |
|
| [»] chr3 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 102 - 322
Target Start/End: Complemental strand, 36379133 - 36378910
Alignment:
| Q |
102 |
catttatggattgggagagaagtgtgacacaggaaacttctacgtatacaaatcata-gagcccacatcgactagttcacaagtaaaaataattgtta-- |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36379133 |
catttatggattgggagagaagtgtgacacaggaaacttctacgtatacaaatcataagagcccacatcgactagttcacaagtaaaaataattgttata |
36379034 |
T |
 |
| Q |
199 |
gagttataaattaagaggacttcttctacctttaccaaacacagagaagtggagccacgaatgaaatgaaatattgaacttttgggttgaaataaagatg |
298 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36379033 |
gagttataaattaagaggacttattctacctttaccaaacacagagatgtggagccacgaatgaaatgaaatattgaacttttgggttgaaataaagata |
36378934 |
T |
 |
| Q |
299 |
aagaggtgatagaaatagacaatt |
322 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
36378933 |
aagagttgatagaaatagacaatt |
36378910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 36379233 - 36379199
Alignment:
| Q |
1 |
atatcttccattaaacatggaattgagtactgaag |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36379233 |
atatcttccattaaacatggaattgagtactgaag |
36379199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 137 - 187
Target Start/End: Complemental strand, 36375924 - 36375873
Alignment:
| Q |
137 |
acttctacgtatacaaatcata-gagcccacatcgactagttcacaagtaaa |
187 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
36375924 |
acttctatgtatacaaatcataagaacccacatcgaccagttcacaagtaaa |
36375873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 190
Target Start/End: Complemental strand, 36383268 - 36383216
Alignment:
| Q |
139 |
ttctacgtatacaaatcata-gagcccacatcgactagttcacaagtaaaaat |
190 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||| |||||||| |||||||| |
|
|
| T |
36383268 |
ttctatgtatacaaatcacaagagcccacatcgaccagttcacaggtaaaaat |
36383216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University