View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11485_high_17 (Length: 284)
Name: NF11485_high_17
Description: NF11485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11485_high_17 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 274
Target Start/End: Original strand, 277014 - 277271
Alignment:
| Q |
17 |
acattgttctcaccaaagatgtcccacttaaccctatcatcaacacttggatacgtttgtttctacctcgcataacacttgacaatcctaaaaaactccc |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
277014 |
acattgttctcaccaaagatgtcccccttaaccctatcatcaacacttggatacgtttgtttctacctcgcatagcacttgacaatcctaaaaaactccc |
277113 |
T |
 |
| Q |
117 |
tctaattttttactaccatggaggtggttttatatattttagtgcttcttcaacggacaaccataacttttgcttcaaattagcgggaaaaatcggcgtc |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
277114 |
tttaattttttactaccatggaggtggttttatatattttagtgcttcttcaacggacaaccataacttttgcttcaaattagcggaaaaaatcggcgtc |
277213 |
T |
 |
| Q |
217 |
gtggttgcctccatcaactatcgtctcgcgccagaatcacgtcttcctgccgcctatg |
274 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
277214 |
gtggttgcgtccatcaactatcgtctcgcaccagaatcgcgtcttcctgccgcctatg |
277271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University