View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11485_high_19 (Length: 236)
Name: NF11485_high_19
Description: NF11485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11485_high_19 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 22 - 236
Target Start/End: Original strand, 36378214 - 36378439
Alignment:
| Q |
22 |
attagtctgcagccacaaacaaatcattttgaaggttccacatttaaggccttta-----------aagtattgagaaacttttgagcatatcttcctta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
36378214 |
attagtctgcagccacaaacaaatcattttgaaggttccacatttaaggcctttataccctccttaaaggattgagaaacttttgagcatatcttcctta |
36378313 |
T |
 |
| Q |
111 |
atagtccttttgcaatatgggcatacattttggtgatttagattactagaaatggcactagattcaattctagtctattttcttgtcatctcatgattca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36378314 |
atagtccttttgcaatatgggcatacattttggtgatttagattactagaaatggcactagattcaattctagtctattttcttgtcatctcatgattca |
36378413 |
T |
 |
| Q |
211 |
agcaattccacttcatatgttccttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36378414 |
agcaattccacttcatatgttccttt |
36378439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 36372735 - 36372794
Alignment:
| Q |
133 |
atacattttg-gtgatttagattactagaaatggcactagattcaattctagtctatttt |
191 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
36372735 |
atacattttgagtgatttagattactagaaatgacattagattcaattctagtccatttt |
36372794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 39 - 73
Target Start/End: Original strand, 36370716 - 36370750
Alignment:
| Q |
39 |
aacaaatcattttgaaggttccacatttaaggcct |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36370716 |
aacaaatcattttgaaggttccacatttaaggcct |
36370750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University