View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11485_high_20 (Length: 236)
Name: NF11485_high_20
Description: NF11485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11485_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 23336911 - 23337133
Alignment:
| Q |
1 |
cttatatgatcacatggaaaattttcttttttatttggttttcagataatatatatgatagataatatcatagagggtgtgac-aagtgtttaattagtt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
23336911 |
cttatatgatcacatggaaaattttcttttttatttggttttcagataatatatatgatagataatatcatagagggtgtgacaaagtg-ttaattagtt |
23337009 |
T |
 |
| Q |
100 |
tcactgacttattttccgtgtgtatataattttgattttgacttagacttgttaannnnnnnnnnnnnnncatttcattctaatcattttgagttacttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23337010 |
tcactgacttattttccgtgtgtatataattttgattttgacttagacttgttaatttttatttttttttcatttcattctaatcattttgagttacttt |
23337109 |
T |
 |
| Q |
200 |
ctgggttggaagaatgatcttttt |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23337110 |
ctgggttggaagaatgatcttttt |
23337133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University