View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11485_low_13 (Length: 346)
Name: NF11485_low_13
Description: NF11485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11485_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 7e-43; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 36537436 - 36537524
Alignment:
| Q |
18 |
agtagttttggtagtcttggaacgtgagagtggaacggttagttaacggaatgagctcattggtggaagtggaacggtttctaagaaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537436 |
agtagttttggtagtcttggaacgtgagagtggaacggttagttaacggaatgagctcattggtggaagtggaacggtttctaagaaat |
36537524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 102 - 183
Target Start/End: Original strand, 36537555 - 36537636
Alignment:
| Q |
102 |
gaaatttagtgtgctcccaagtcccaatgaatggagtgattctcattcaccattgttaatcgaaattacaaaaattatgtgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537555 |
gaaatttagtgtgctcccaagtcccaatgaatggagtgattttcattcaccattgttaatcgaaattacaaaaattatgtgt |
36537636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 198 - 227
Target Start/End: Original strand, 36537715 - 36537744
Alignment:
| Q |
198 |
ttcaataatgatttttcatattctaaaata |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36537715 |
ttcaataatgatttttcatattctaaaata |
36537744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University