View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11485_low_18 (Length: 253)
Name: NF11485_low_18
Description: NF11485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11485_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 85 - 214
Target Start/End: Complemental strand, 36538515 - 36538386
Alignment:
| Q |
85 |
atatgcttattaaccgtgatcaatgcttctattcctataaattcttttgagctagtgagctttgagattctctgcatttcttaaaagcgataaataatgg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
36538515 |
atatgcttattaaccgtgatcaatgcttgtattcctataaattcttttgagctagtgagctttgaaattctcggcatttcttaaaagcgataaataatgg |
36538416 |
T |
|
| Q |
185 |
aggggtcaatcacgagagagattgttgcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36538415 |
aggggtcaatcacgagagagattgttgcaa |
36538386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 93
Target Start/End: Complemental strand, 36539098 - 36539021
Alignment:
| Q |
16 |
tgaactcttaaaagaagtgaccatgagttttattggttcaattattttattattaaattaccgtttgaaatatgctta |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
36539098 |
tgaactcttaaaagaagtgaccatgagttttattggttcaattattttattaataaattactgtttgaaatatgctta |
36539021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University