View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11486_high_13 (Length: 213)
Name: NF11486_high_13
Description: NF11486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11486_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 33632132 - 33631950
Alignment:
| Q |
13 |
cgataagcttaaaatcttgcagccttcacaaatcgatatatcccttgctccttattatggtttgttactgtttgcacaccccctctactatgcctcgttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33632132 |
cgataagcttaaaatcttgcagccttcacaaatcgatatatcccttgctccttgttatggtttgttactgtttgcacaccccctctactatgcctcgttt |
33632033 |
T |
 |
| Q |
113 |
tgtacttcattggcttgaggaccgtggccagacattgttggattttgcaagctctatagtcttctgccagattggccacttct |
195 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33632032 |
tgtacttcattggcttgaggactgttgccagacattgttggattttgcaagctctatagtcttctgccagattggccacttct |
33631950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 75 - 191
Target Start/End: Complemental strand, 50948792 - 50948676
Alignment:
| Q |
75 |
tgttactgtttgcacaccccctctactatgcctcgttttgtacttcattggcttgaggaccgtggccagacattgttggattttgcaagctctatagtct |
174 |
Q |
| |
|
||||||||||||||| |||| ||| |||||| || ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50948792 |
tgttactgtttgcacgccccatctgctatgcttcattttgtacttcattggcttgaggactgttgccagacattgttggattttgcaagctctatagtct |
50948693 |
T |
 |
| Q |
175 |
tctgccagattggccac |
191 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
50948692 |
tctgccagattggccac |
50948676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 63 - 196
Target Start/End: Complemental strand, 50958034 - 50957901
Alignment:
| Q |
63 |
cttattatggtttgttactgtttgcacaccccctctactatgcctcgttttgtacttcattggcttgaggaccgtggccagacattgttggattttgcaa |
162 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||| ||||||||| ||||| ||||||||| |||||||| || || ||||||||||||||| ||||| |
|
|
| T |
50958034 |
cttattttggtttgttactgtttgcataccgcctctgttatgcctcgatttgttcttcattggtttgaggactgttgctagacattgttggattctgcaa |
50957935 |
T |
 |
| Q |
163 |
gctctatagtcttctgccagattggccacttctg |
196 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
50957934 |
gctctgtagtctttggccagcttggccacttctg |
50957901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 174
Target Start/End: Complemental strand, 15856279 - 15856176
Alignment:
| Q |
71 |
ggtttgttactgtttgcacaccccctctactatgcctcgttttgtacttcattggcttgaggaccgtggccagacattgttggattttgcaagctctata |
170 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||| |||||| ||||| |||||||||||| || || | ||||||||||||| || ||||| |||| |
|
|
| T |
15856279 |
ggtttgttactgtttgtacaccccttcttttatgcctcattttgttcttcactggcttgaggactgttgctacacattgttggattatggaagctttata |
15856180 |
T |
 |
| Q |
171 |
gtct |
174 |
Q |
| |
|
|||| |
|
|
| T |
15856179 |
gtct |
15856176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University