View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11486_high_13 (Length: 213)

Name: NF11486_high_13
Description: NF11486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11486_high_13
NF11486_high_13
[»] chr5 (1 HSPs)
chr5 (13-195)||(33631950-33632132)
[»] chr1 (3 HSPs)
chr1 (75-191)||(50948676-50948792)
chr1 (63-196)||(50957901-50958034)
chr1 (71-174)||(15856176-15856279)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 195
Target Start/End: Complemental strand, 33632132 - 33631950
Alignment:
13 cgataagcttaaaatcttgcagccttcacaaatcgatatatcccttgctccttattatggtttgttactgtttgcacaccccctctactatgcctcgttt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
33632132 cgataagcttaaaatcttgcagccttcacaaatcgatatatcccttgctccttgttatggtttgttactgtttgcacaccccctctactatgcctcgttt 33632033  T
113 tgtacttcattggcttgaggaccgtggccagacattgttggattttgcaagctctatagtcttctgccagattggccacttct 195  Q
    |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33632032 tgtacttcattggcttgaggactgttgccagacattgttggattttgcaagctctatagtcttctgccagattggccacttct 33631950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 75 - 191
Target Start/End: Complemental strand, 50948792 - 50948676
Alignment:
75 tgttactgtttgcacaccccctctactatgcctcgttttgtacttcattggcttgaggaccgtggccagacattgttggattttgcaagctctatagtct 174  Q
    ||||||||||||||| |||| ||| |||||| || ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||    
50948792 tgttactgtttgcacgccccatctgctatgcttcattttgtacttcattggcttgaggactgttgccagacattgttggattttgcaagctctatagtct 50948693  T
175 tctgccagattggccac 191  Q
    |||||||||||||||||    
50948692 tctgccagattggccac 50948676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 63 - 196
Target Start/End: Complemental strand, 50958034 - 50957901
Alignment:
63 cttattatggtttgttactgtttgcacaccccctctactatgcctcgttttgtacttcattggcttgaggaccgtggccagacattgttggattttgcaa 162  Q
    |||||| ||||||||||||||||||| ||| |||||  ||||||||| ||||| ||||||||| |||||||| || || ||||||||||||||| |||||    
50958034 cttattttggtttgttactgtttgcataccgcctctgttatgcctcgatttgttcttcattggtttgaggactgttgctagacattgttggattctgcaa 50957935  T
163 gctctatagtcttctgccagattggccacttctg 196  Q
    ||||| |||||||  ||||| |||||||||||||    
50957934 gctctgtagtctttggccagcttggccacttctg 50957901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 174
Target Start/End: Complemental strand, 15856279 - 15856176
Alignment:
71 ggtttgttactgtttgcacaccccctctactatgcctcgttttgtacttcattggcttgaggaccgtggccagacattgttggattttgcaagctctata 170  Q
    |||||||||||||||| ||||||| |||  |||||||| |||||| ||||| |||||||||||| || || | ||||||||||||| || ||||| ||||    
15856279 ggtttgttactgtttgtacaccccttcttttatgcctcattttgttcttcactggcttgaggactgttgctacacattgttggattatggaagctttata 15856180  T
171 gtct 174  Q
    ||||    
15856179 gtct 15856176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University