View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11486_high_9 (Length: 240)
Name: NF11486_high_9
Description: NF11486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11486_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 226
Target Start/End: Complemental strand, 44041539 - 44041324
Alignment:
| Q |
11 |
caaaggtaaaatttggagctgaggaatcaatagtccaaatctacaaaaacagtaaattggtacaaaatgttagttaatgattttgaaacatgtagtaaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44041539 |
caaaggtaaaatttggagctgaggaatcaatagtccaaatctacaaaaacagtaaattggtacaaaatgttagttaatgattttgaaatatgtagtaaga |
44041440 |
T |
|
| Q |
111 |
agcagggttttagaaagttgcatcaacaagatttgatcccgacactccacaataatatcgaggattatgacgctagccttgagcccttgaccataagaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
44041439 |
agcagggttttagaaagttgcatcaacaagatttgatcccgacactccacaattatatcgaggatcatcacgctagccttgagcccttgaccatacgaat |
44041340 |
T |
|
| Q |
211 |
tacagttgaggatttt |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44041339 |
tacagttgaggatttt |
44041324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University